View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1367_low_9 (Length: 337)
Name: NF1367_low_9
Description: NF1367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1367_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 98 - 209
Target Start/End: Original strand, 7366414 - 7366525
Alignment:
| Q |
98 |
tactgatcaatcaacaatgggtgaagagcgtaaggtgttcactttggctgatgtctccaagcataacagtgccaaagactgttggcttgttattcataac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7366414 |
tactgatcaatcaacaatgggtgaagagcgtaaggtgttcactttggctgatgtctctaagcataacagtgccaaagactgttggcttgttattcataac |
7366513 |
T |
|
| Q |
198 |
aaggtaatgctg |
209 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7366514 |
aaggtaatgctg |
7366525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University