View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368-INSERTION-1 (Length: 104)
Name: NF1368-INSERTION-1
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368-INSERTION-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 9 - 104
Target Start/End: Original strand, 29518911 - 29519006
Alignment:
| Q |
9 |
aacatacattaagatgttgagaggaagatcgagagcgaggaagttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29518911 |
aacatacattaagatgttgagaggaagatcgagagcgaggaagttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattat |
29519006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 40101112 - 40101068
Alignment:
| Q |
9 |
aacatacattaagatgttgagaggaagatcgagagcgaggaagtt |
53 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
40101112 |
aacaaacattaagatgttgagaggaagatcaagagcaatgaagtt |
40101068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University