View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368-INSERTION-3 (Length: 265)
Name: NF1368-INSERTION-3
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368-INSERTION-3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 82
Target Start/End: Complemental strand, 17443538 - 17443472
Alignment:
| Q |
16 |
gttggatttaataggccacggtgttttggtcaatagaaatagttttattcataaatatcacacttat |
82 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17443538 |
gttgaatttaataggccacggtgttttggttaatagaaatagttttattcataaatatcacacttat |
17443472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 225 - 265
Target Start/End: Complemental strand, 17442832 - 17442792
Alignment:
| Q |
225 |
ttaacaaaattaaagaactcatagttatgggacaaagttat |
265 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17442832 |
ttaaaaaaattaaagaactcatagtcatgggacaaagttat |
17442792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University