View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13682_high_7 (Length: 205)

Name: NF13682_high_7
Description: NF13682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13682_high_7
NF13682_high_7
[»] chr2 (1 HSPs)
chr2 (17-190)||(2181643-2181817)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 2181643 - 2181817
Alignment:
17 aaaatatttaggaacaaagtaaaatgaatatacaagatcttt-cgaaaggatttagaccttttcttacgacttacagaatgaatttggacttaattgtag 115  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||| ||||||    
2181643 aaaatatttaggaacaaagtaaaatgaatatacaagatcttttcgaaaggatttagaccttttcttacgacttacggagtgaatttggacttagttgtag 2181742  T
116 ttatgttaattcgagcaccttgatggtttgaagatgacttttaattcatagaaacactgaaaataaggaaaatgt 190  Q
    ||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||    
2181743 ttatgttaattcgagcatcttgatggcttgaagatggcttttaattcatagaaacactgaaaataaggaaaatgt 2181817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University