View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13682_low_6 (Length: 316)
Name: NF13682_low_6
Description: NF13682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13682_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 309
Target Start/End: Original strand, 26920239 - 26920532
Alignment:
| Q |
16 |
cactttcccttcttctgtaacaaaccactagactttttcttatttggatcagtcccttcagaaccagcttcatcaccaatgtaataaacagccattatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920239 |
cactttcccttcttctgtaacaaaccactagactttttcttatttggatcagtcccttcagaaccagcttcatcaccaatgtaataaacagccattatca |
26920338 |
T |
|
| Q |
116 |
atagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttgggtcaccaccagagctttcttcagctggaaaatttggttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920339 |
atagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttgggtcaccaccagagctttcttcagctggaaaatttggttc |
26920438 |
T |
|
| Q |
216 |
atcttcatcactcatctgagaactttgttgttgctgtttgttcttggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920439 |
atcttcatcactcatctgagaactttgttgttgctgtttgttcttggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgt |
26920532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 78 - 227
Target Start/End: Complemental strand, 41824983 - 41824834
Alignment:
| Q |
78 |
accagcttcatcaccaatgtaataaacagccattatcaatagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttggg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
41824983 |
accagcttcatcaccaatgtaataaacagccattattaagagtcttaccattgtatctgtccatttcattctatgccatggtgatccttttctttttggg |
41824884 |
T |
|
| Q |
178 |
tcaccaccagagctttcttcagctggaaaatttggttcatcttcatcact |
227 |
Q |
| |
|
|||||| ||||| |||| || ||| |||| |||||||||||||||||| |
|
|
| T |
41824883 |
tcaccaacagaggtttcatctgctccaaaacatggttcatcttcatcact |
41824834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University