View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13682_low_8 (Length: 205)
Name: NF13682_low_8
Description: NF13682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13682_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 2181643 - 2181817
Alignment:
| Q |
17 |
aaaatatttaggaacaaagtaaaatgaatatacaagatcttt-cgaaaggatttagaccttttcttacgacttacagaatgaatttggacttaattgtag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
2181643 |
aaaatatttaggaacaaagtaaaatgaatatacaagatcttttcgaaaggatttagaccttttcttacgacttacggagtgaatttggacttagttgtag |
2181742 |
T |
|
| Q |
116 |
ttatgttaattcgagcaccttgatggtttgaagatgacttttaattcatagaaacactgaaaataaggaaaatgt |
190 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2181743 |
ttatgttaattcgagcatcttgatggcttgaagatggcttttaattcatagaaacactgaaaataaggaaaatgt |
2181817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University