View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13683_high_19 (Length: 341)
Name: NF13683_high_19
Description: NF13683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13683_high_19 |
 | |
|
| [»] scaffold0256 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 13 - 170
Target Start/End: Complemental strand, 16737733 - 16737577
Alignment:
| Q |
13 |
tcatatcttccctcgttatattgctttttctatttccattgatttcaccttgaacatcctcgttggttatatttttacaaatctacaaatgtgaccaata |
112 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| ||||||||||||||||| ||||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
16737733 |
tcatattttccctcgt-atattgctctttttatttccattgatttcatcttgaacatcctcattggtcatatttttacaaatcgacaaatgtgaccaata |
16737635 |
T |
|
| Q |
113 |
tttttgcagtgagtgcaaaaatctagtaagtttctgtaatcaagttccacaaaatatg |
170 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
16737634 |
tttttgcagtaagtgcaaaaatttagtaagtttttgtaatcaagttcaacaaaatatg |
16737577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 335
Target Start/End: Complemental strand, 16737160 - 16737054
Alignment:
| Q |
229 |
actttaacaaatccttctaatgtggattgcatcctttgaccaaacgatccttgcatgaagattctgtttgaatgcatcaaaaccacctagatactcatat |
328 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| ||||||||||||||||||||| |
|
|
| T |
16737160 |
actttaacaaattcttctaatgtggattgcatcctttgaccaaatgatccttgcatgaagattgtgtttgcatgcatgaaaaccacctagatactcatac |
16737061 |
T |
|
| Q |
329 |
tcttgga |
335 |
Q |
| |
|
||||||| |
|
|
| T |
16737060 |
tcttgga |
16737054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 13154 - 12984
Alignment:
| Q |
1 |
gtttttcccttatcatatcttccctcgttatattgctttttctatttccattgatttcaccttgaacatcctcgttggttatatttttacaaatctacaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| ||| ||||| ||||||||||| ||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
13154 |
gtttttccctaatcatatcttcccttattatattgccctttttattttcattgatttcatcttgaacatcctccttggtaatatttttacaaatcgacaa |
13055 |
T |
|
| Q |
101 |
atgtgaccaatatttttgcagtgagtgc-aaaaatctagtaagtttctgtaatcaagttccacaaaatatg |
170 |
Q |
| |
|
||||| ||||| |||||||| | ||| | |||||||||||||||| | | |||||||||| |||||||||| |
|
|
| T |
13054 |
atgtgcccaatgtttttgcaataagtacaaaaaatctagtaagttaccgcaatcaagttcaacaaaatatg |
12984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University