View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13683_high_21 (Length: 328)
Name: NF13683_high_21
Description: NF13683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13683_high_21 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 176 - 328
Target Start/End: Original strand, 40799391 - 40799543
Alignment:
| Q |
176 |
ggtctgccaaatctcacctgttaattttgtgtatggatggtgatccacacaccaacaaaaacatgaagaaataagtttagcaaatttgaaaggccttttc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40799391 |
ggtctgccaaatctcacctgttaattttgtgtatggatggtgatccacacaccaacaaaaacatgaagaaataagtttaggaaatttgaaaggccttttc |
40799490 |
T |
|
| Q |
276 |
ctcatcactgtattgccacaaactaaggttattctattagaaaggggcataaa |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40799491 |
ctcatcactgtattgccacaaactaaggttattctattagaaaggggcataaa |
40799543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 9 - 113
Target Start/End: Original strand, 40799224 - 40799328
Alignment:
| Q |
9 |
gagatgaagaaggggaaaagggaggaagaagatggaacaatttgatgtagcctattttcctccaccattaattaaagtgtttaaggtaaatgcaattata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40799224 |
gagatgaagaaggggaaaagggaggaagaagatggaacaacttgatgtagcctattttcctcgaccattaattaaagtgtttaaggtaaatgcaattata |
40799323 |
T |
|
| Q |
109 |
taggc |
113 |
Q |
| |
|
||||| |
|
|
| T |
40799324 |
taggc |
40799328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University