View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13685_high_1_N (Length: 329)
Name: NF13685_high_1_N
Description: NF13685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13685_high_1_N |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 39303114 - 39303427
Alignment:
| Q |
1 |
ctttatgcatgattgtaattttcctcttacaataaacgcatnnnnnnnnnnnnnnttctattgcgattgtgacattttttcacgaacgaagatttaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||| ||||||||| || |
|
|
| T |
39303114 |
ctttatgcatgattgtaattttcctcttacaataaacgcataaacaaatagaa--ttctactgcgattgtgacattttttcacaaaccaagatttaattt |
39303211 |
T |
|
| Q |
101 |
gatctttcacaattttttcgatgatttaatttagtcatggacaaaaagtgaaatcaaattagtcactaacatttttaattaaagacaaacttgttctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39303212 |
gatctttcacaattttttcgatgatttaatttagtcatggacaaaaaatcaaatcaaattagtcactaacatttttaattaaagacaaacttgttct-tg |
39303310 |
T |
|
| Q |
201 |
tataaaaatgtcattgggccgcgagaaatttacgaggaatcaaattgaatcttttactgatcttttcattccaagtctccatctagaatcgaccaaaaag |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39303311 |
t-taaaaatgtcattgggccgcgagaaatttacgaggaatcaaattgagtcttttactgatcttttcattccaagtctccatctagaatcgaccaaaaag |
39303409 |
T |
|
| Q |
301 |
tgcagcatgaatagaatt |
318 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
39303410 |
tgcaccatgaatagaatt |
39303427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University