View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_high_22 (Length: 240)
Name: NF13686_high_22
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 42538054 - 42538155
Alignment:
| Q |
18 |
atagcaaggctgataattttttattttaatcatgtttgttggcctaataacggtctccaactaatattagaaaatggttttgttaacgagtatctccgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | | || |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42538054 |
atagcaaggctgataattttttattttaatcatgtttgttggcctaataatgatttctaactaatattag-aaatggttttgttaacgagtatctccgta |
42538152 |
T |
 |
| Q |
118 |
aca |
120 |
Q |
| |
|
||| |
|
|
| T |
42538153 |
aca |
42538155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University