View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_high_24 (Length: 237)
Name: NF13686_high_24
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 19316051 - 19316266
Alignment:
| Q |
1 |
tgaatggttttgattggtagaaactcagcatgagtaactctacccactttttggtgctgggtattattgttgctaccattccactcacccaaatcacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
19316051 |
tgaatggttttgattggtagaaactcagcatgagaaactctacccactttttggtgccgggtattattgttgccacctttccactcacccaaatcacaaa |
19316150 |
T |
 |
| Q |
101 |
attttctgtnnnnnnnntgtatatacga-agtggtcgtgcgttcaccttcgtggttgtaccaccctctactcttctaagagggtcttttagtcaacggca |
199 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
19316151 |
attttctgtaaaaaaaatgtatatacgatggtggtcgtgcgttcaccttcgtggttgtaccaccctctactcctctgacagggtcttttagtcaacggca |
19316250 |
T |
 |
| Q |
200 |
tcacgtctccacgacc |
215 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
19316251 |
tcgcgtctccacgacc |
19316266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University