View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_high_26 (Length: 235)
Name: NF13686_high_26
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 51257828 - 51257608
Alignment:
| Q |
1 |
ccaatagcggttcaatcagatttggctcatctaaaatgaatagaaaataaaattggaaaattagtggttgacattttaacttattcatgatttattataa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51257828 |
ccaatagcggttcaatcggatttggctcatctaaaatgaatagagaataaaattggaaaattagtggttgacattttaacttattcatgatttattataa |
51257729 |
T |
 |
| Q |
101 |
tgtacataaatatcaactattggtttatctatcaacgattgatattttcaatttagaggagccgaaaatcataacatatggttcaatcaatgcatttata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
51257728 |
tgtacataaatatcaactattggtttatctatcaaagattgatattttcaatttagaggagccgaaaatcataacgtatggttcaatcaatgcatgaata |
51257629 |
T |
 |
| Q |
201 |
gtattgaaatatactattagc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51257628 |
gtattgaaatatactattagc |
51257608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University