View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13686_high_30 (Length: 205)

Name: NF13686_high_30
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13686_high_30
NF13686_high_30
[»] chr2 (2 HSPs)
chr2 (122-156)||(11654384-11654418)
chr2 (122-156)||(11668149-11668183)


Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 122 - 156
Target Start/End: Complemental strand, 11654418 - 11654384
Alignment:
122 ttatgttggttatgtggtggagaagagctattagg 156  Q
    |||||||||||||||||||||||||||||||||||    
11654418 ttatgttggttatgtggtggagaagagctattagg 11654384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 122 - 156
Target Start/End: Complemental strand, 11668183 - 11668149
Alignment:
122 ttatgttggttatgtggtggagaagagctattagg 156  Q
    |||||||||||||||||||||||||||||||||||    
11668183 ttatgttggttatgtggtggagaagagctattagg 11668149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University