View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_high_8 (Length: 354)
Name: NF13686_high_8
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 29244434 - 29244258
Alignment:
| Q |
13 |
aatatacatcgatgattttatttttgaagggaatatacattgatggttataactgggaatattcgatatatttatttatctagtaatagaaggcatatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29244434 |
aatatacatcgatgattttatttttgaagggaatatacattgatggttataactgggaatattcgatatatttatttatctagtaatagaaggcatatgc |
29244335 |
T |
 |
| Q |
113 |
cattggaatattcctcatttgataaaatgtagattctttataacggtatctgcactcttgcctaaaaaagaaaagaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29244334 |
cattggaatattcctcatttgataaaatgtagattctttataacggtatctgcactcttccctaaaaaagaaaagaa |
29244258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 247 - 336
Target Start/End: Complemental strand, 29244264 - 29244175
Alignment:
| Q |
247 |
aaaagaataatgctagactcattttcaggagagatgcatgatatgcaataaacggagcatggttttttcgtggaaaacttgactagcctc |
336 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
29244264 |
aaaagaataatgctagactcattttcaagagagatgcatgatatgcaataaacggatcatggttttttgttggaaaacttgactagcctc |
29244175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University