View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_low_13 (Length: 285)
Name: NF13686_low_13
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 267
Target Start/End: Original strand, 48286463 - 48286713
Alignment:
| Q |
17 |
aatatagtttcaacatttcttcttcagcatcttccaatgtctttgaggcagaagagaaataacaagaactgcaacagttcatacatacgcgaacgttaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
48286463 |
aatatagtttcaacatttcttcttcagcatcttccaatgtctttgaggcagaagagaaataacaagaactgcaccagttcatacatacgcgaacgtcaca |
48286562 |
T |
 |
| Q |
117 |
taaatcataaggttgtgcacataattttactattttccttgtgcaaatcttttatattaccaacaaacaatcattttacatcgtatcaaggatttgttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286563 |
taaatcataaggttgtgcacataattttactattttccttgtgcaaatcttttatattaccaacaaacaatcattttacatcgtatcaaggatttgttta |
48286662 |
T |
 |
| Q |
217 |
taaagaatctttacacttgtatctactatagcctttaccctacccccatat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286663 |
taaagaatctttacacttgtatctactatagcctttaccctacccccatat |
48286713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University