View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_low_18 (Length: 251)
Name: NF13686_low_18
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 25 - 246
Target Start/End: Complemental strand, 5053839 - 5053618
Alignment:
| Q |
25 |
caacagtattgccactgtaatacaagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataa |
124 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5053839 |
caacagtattgccactgtaatataagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataa |
5053740 |
T |
|
| Q |
125 |
aggtttgcaacataactagaaccactatatataatctatagttggtagtattagttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaa |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5053739 |
aggtttgcaacgtaactagaaccactatatataatctatagttggtagtattagttttgccaccgtcgagggacaatagtagttgtatagttttcagaaa |
5053640 |
T |
|
| Q |
225 |
ttgattcaaattctgtgctgct |
246 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
5053639 |
ttgattcaaattctgtgatgct |
5053618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 5053886 - 5053828
Alignment:
| Q |
21 |
tccgcaacagtattgccactgtaatacaagggattttaaagtctccacaacagtattgc |
79 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
5053886 |
tccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgc |
5053828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University