View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_low_20 (Length: 246)
Name: NF13686_low_20
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 79 - 225
Target Start/End: Original strand, 45699036 - 45699182
Alignment:
| Q |
79 |
taagaatgaatgaatctagggttcgtgagcggcgaccaatagacaaacaataatattctcaaatggacgacggacggacggacccacttaacaaacaact |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45699036 |
taagaatgaatgaatctagggttcgtgagcggcgaccaatagacaaacaataatattctcaaatggacgacggacggacggacccacttaacaaacaact |
45699135 |
T |
 |
| Q |
179 |
tctaatcttctaataatagagggaccaggacggacgttgttcgatct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45699136 |
tctaatcttctaataatagagggaccaggacggacgttgttcgatct |
45699182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 46
Target Start/End: Original strand, 45698969 - 45698998
Alignment:
| Q |
17 |
gagaagaaagaggagattgatttcagggag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45698969 |
gagaagaaagaggagattgatttcagggag |
45698998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University