View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13686_low_22 (Length: 240)

Name: NF13686_low_22
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13686_low_22
NF13686_low_22
[»] chr7 (1 HSPs)
chr7 (18-120)||(42538054-42538155)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 42538054 - 42538155
Alignment:
18 atagcaaggctgataattttttattttaatcatgtttgttggcctaataacggtctccaactaatattagaaaatggttttgttaacgagtatctccgta 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | | || |||||||||||| |||||||||||||||||||||||||||||    
42538054 atagcaaggctgataattttttattttaatcatgtttgttggcctaataatgatttctaactaatattag-aaatggttttgttaacgagtatctccgta 42538152  T
118 aca 120  Q
    |||    
42538153 aca 42538155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University