View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13686_low_23 (Length: 240)
Name: NF13686_low_23
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13686_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 51257842 - 51258072
Alignment:
| Q |
1 |
cacaacgattgagtttttcgtgaatctgtttaacttgatacaattagcaaaaatcaatcacnnnnnnnnnnnnnnnnnnnnnnnntatagaattgaatcc |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51257842 |
cacaacgattgagttttttgtgaatctgtttaacttgatacaattagcaaaaatcaatcacagaaatcaaagaaaaacttaaaaatatagaattgaatcc |
51257941 |
T |
|
| Q |
101 |
atttaaaccaaagtttagctatgaaattatagcagtatcatatttatgcaattttcactttgatttgtttctcaattttattttctcagtcacctcatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51257942 |
atttaaaccaaagtttagctatgaaattatagcagtatcatatttatgcaattttcactttgatttgtttctcaattttattttctcagtcacctcatga |
51258041 |
T |
|
| Q |
201 |
tcagtatattatgctatgcagatgatgatgt |
231 |
Q |
| |
|
| ||||||||||| |||||||||| |||||| |
|
|
| T |
51258042 |
ttagtatattatgatatgcagatgttgatgt |
51258072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University