View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13686_low_29 (Length: 219)

Name: NF13686_low_29
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13686_low_29
NF13686_low_29
[»] chr5 (1 HSPs)
chr5 (16-200)||(23136388-23136572)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 23136572 - 23136388
Alignment:
16 aatatcaaactaactattgtacttctatttatttatatgtttcagatcatcaacatctaaaatcataatcatatgtccagtcactttaggaaattgggaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23136572 aatatcaaactaactattgtacttctatttatttatatgtttcagatcatcaacatctaaaatcataatcatatgtccagtcactttaggaaattgggaa 23136473  T
116 tattctttctaccttcactcgaatattattggtacttgcttgtgaagatagaattcatcaaccataaaatatctaccacgcttta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23136472 tattctttctaccttcactcgaatattattggtacttgcttgtgaagatagaactcatcaaccataaaatatctaccacgcttta 23136388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University