View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13689_high_3 (Length: 270)
Name: NF13689_high_3
Description: NF13689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13689_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 49762318 - 49762558
Alignment:
| Q |
19 |
cacttcaggtttgaatctcgcaagaaaaaaccatttggtccaaaattagatgtgagcactatttgatttgccaagtatgtttcccnnnnnnnnnnnnnag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49762318 |
cacttcaggtttgaatctcgcaagaaaaaaccatttggtccaaaattagatgtgagcactatttgatttgccaagtatgtttcccttttttattttttag |
49762417 |
T |
 |
| Q |
119 |
tttaattctgttaaataaatcttgctatagttcactgcagaagatgctgttcatcatcagcttgaagcattgaagtataatgaccagcctcgtcaagatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49762418 |
tttaattctgttaaataaatcttgctatagttcactgcagaagatgctgttcatcatcagcttgaagcattgaagtataatgaccagcctcgtcaagatt |
49762517 |
T |
 |
| Q |
219 |
atggaattgaagtcatgtacagagtaggctaatcatttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49762518 |
atggaattgaagtcatgtacagagtaggctaatcatttcat |
49762558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University