View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13689_low_6 (Length: 236)
Name: NF13689_low_6
Description: NF13689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13689_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 68 - 221
Target Start/End: Original strand, 52478421 - 52478594
Alignment:
| Q |
68 |
tatatggtatcaatgcccaagttctcagttggatttttatgtgtacttaacatcattcaactgtggtaatcgtcaaatg--------------------a |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52478421 |
tatatggtatcaatgcccaagttctcagttggatttttatgtgtacttaacatcattcaactgtggtaatcgtcaaatgttttcacaaacttgatgacaa |
52478520 |
T |
 |
| Q |
148 |
tttagcataaatgaggcttcctttgtcaaccgagtatggtagtgggatgatggtaacatttatatagtaatagt |
221 |
Q |
| |
|
| ||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478521 |
tatagcatacattaggcttcctttgtgaaccgagtatggtagtgggatgatggtaacatttatatagtaatagt |
52478594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 52478324 - 52478394
Alignment:
| Q |
1 |
aagtcatcatggctttattagagatgttacccacggttcaatttgcttcttggtgggtgcctcattgtata |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478324 |
aagtcatcatggctttattagagatgttacccacggttcaatttgcttcttggtgggtgcctcattgtata |
52478394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University