View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13689_low_7 (Length: 224)

Name: NF13689_low_7
Description: NF13689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13689_low_7
NF13689_low_7
[»] chr1 (1 HSPs)
chr1 (27-206)||(45548602-45548781)
[»] chr5 (2 HSPs)
chr5 (27-98)||(21846614-21846685)
chr5 (46-87)||(19671274-19671315)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 27 - 206
Target Start/End: Complemental strand, 45548781 - 45548602
Alignment:
27 gaaactagagaaaatttcgataccatcacaaacaccattgagaaacaatcaggttatgaagaaccagtggagacgcaaccaaaacaaaaaggttacacag 126  Q
    |||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45548781 gaaattagagaaaattttgataccatcacaaacaccgttgagaaacaatcaggttatgaagaaccagtggagacgcaaccaaaacaaaaaggttacacag 45548682  T
127 atgaaattgaaatctcgtctgcggaagaagctgataaaactctccctcctgaaaatgacgaagcttctaagctcggaaat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45548681 atgaaattgaaatctcgtctgcggaagaagctgataaaactctccctcctgaaaatgacgaagcttctaagctcggaaat 45548602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 27 - 98
Target Start/End: Complemental strand, 21846685 - 21846614
Alignment:
27 gaaactagagaaaatttcgataccatcacaaacaccattgagaaacaatcaggttatgaagaaccagtggag 98  Q
    |||||||||||||| ||| ||||||| ||||||||| |||| ||||||||||||||||||||||||||||||    
21846685 gaaactagagaaaacttcaataccattacaaacaccgttgaaaaacaatcaggttatgaagaaccagtggag 21846614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 19671274 - 19671315
Alignment:
46 ataccatcacaaacaccattgagaaacaatcaggttatgaag 87  Q
    |||||||| ||| |||||||||||||||| ||||||||||||    
19671274 ataccatcccaaccaccattgagaaacaaccaggttatgaag 19671315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University