View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_20 (Length: 376)
Name: NF1368_high_20
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 351
Target Start/End: Complemental strand, 40859079 - 40858760
Alignment:
| Q |
30 |
agctgcagatgttcagaatgtgttccttgagcaggtgcttctaagtcaaactatactaacacttgtctactttttgtatgttaataattgcaggagatga |
129 |
Q |
| |
|
||||||||||||| || |||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40859079 |
agctgcagatgtttggagtgtgttacttgagcaagtgcttctaagtcaaactatactaatacttgtctactttttgtatgttaataatggcaggagatga |
40858980 |
T |
|
| Q |
130 |
ttgcaagattaaggtatgagaagtcgatactcacagttgttctttaacttttctaggacacaaaggatcaataaatactcttgagtttcataagaactat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| | |
|
|
| T |
40858979 |
ttgcaagattaaggtatgagaagtcgatactcacagttgttctttaacttttctaggacacaaagaatcaataattactcttgagtttcataagaactgt |
40858880 |
T |
|
| Q |
230 |
ccatggtttttgagcgcaagctccgacaaaactatcagcatctagaaccacaaggaaggcacttgcatgtccactttacctgctcaagctggctgagtca |
329 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| |||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
40858879 |
ccatcgtttttgagcgcaagcttcgacaaagctatcagcatttagaaccaca--gaaggcacttgcatgtccactttacttgctcaagctggctaagtca |
40858782 |
T |
|
| Q |
330 |
catgggcgaattttcaccaaag |
351 |
Q |
| |
|
||| | |||||||||||||||| |
|
|
| T |
40858781 |
catcgacgaattttcaccaaag |
40858760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University