View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1368_high_26 (Length: 345)

Name: NF1368_high_26
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1368_high_26
NF1368_high_26
[»] chr5 (1 HSPs)
chr5 (107-249)||(43017059-43017197)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 107 - 249
Target Start/End: Complemental strand, 43017197 - 43017059
Alignment:
107 acctccccaatcatatatttaatcatcggaagtattaattagtccatgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaa 206  Q
    |||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43017197 acctccccaatcatatatttaatcatcggaagtatta----gtccatgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaa 43017102  T
207 ttgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg 249  Q
    |||||||||||||||||||||||||||||||||||||||||||    
43017101 ttgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg 43017059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University