View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_26 (Length: 345)
Name: NF1368_high_26
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 107 - 249
Target Start/End: Complemental strand, 43017197 - 43017059
Alignment:
| Q |
107 |
acctccccaatcatatatttaatcatcggaagtattaattagtccatgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017197 |
acctccccaatcatatatttaatcatcggaagtatta----gtccatgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaa |
43017102 |
T |
|
| Q |
207 |
ttgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017101 |
ttgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg |
43017059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 40607 times since January 2019
Visitors: 6346