View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_29 (Length: 344)
Name: NF1368_high_29
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 14339181 - 14339094
Alignment:
| Q |
171 |
tatggacaattttctatttcatgaggaaacttccaggctttatcaaagttttgattagattaaaggaca-gaaaaattaatagaaaaa |
257 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || | ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14339181 |
tatggacaattttctatttgatgaggaaacttctgggatctatcaaagttttgattagattaaaggacataaaaaattaatagaaaaa |
14339094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University