View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_45 (Length: 270)
Name: NF1368_high_45
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 54 - 265
Target Start/End: Complemental strand, 8060811 - 8060600
Alignment:
| Q |
54 |
aagtattgcctaaagccatatattaattatgaaattctttattctgacctgctatgattcttcaacgtggtagtggggttagaaagagggtgcctttcgg |
153 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8060811 |
aagtattacctaaagccatatattaattatgaaattctttattctgacctgctatgattcttcaacgtggtagtggggttagaaagagggtgcctttcgg |
8060712 |
T |
|
| Q |
154 |
ttatgacccactagatatattcacgggcacttgcttccctttgttgtttagcaaaaagccacaaaatcagagcctctcttttatcaaatttgtcacttag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8060711 |
ttatgacccactagatatattcacgggcacttgcttccctttgttgtttagcaaaaagccacaaaatcagagtctctcttttatcaaatttgtcacttag |
8060612 |
T |
|
| Q |
254 |
ttctgtggtgct |
265 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
8060611 |
ttgtgtggtgct |
8060600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University