View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_46 (Length: 266)
Name: NF1368_high_46
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 30 - 264
Target Start/End: Complemental strand, 1922630 - 1922398
Alignment:
| Q |
30 |
attcagacatgacatgtttacaatatttgaatacaattttattgcagacttgttaactttagtcaaactatcatgagctgtttgattgaattgcctatgc |
129 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1922630 |
attcatacatgacatgtttgcaatatttgaatacaattttattgcagacttgttaactttagtcaaactatcatgagctgtttgattgaattgcctatgc |
1922531 |
T |
 |
| Q |
130 |
aataacagtgtttcacacaattagagcaaccaatatagcattcctttcgtcgttcca-aataataggcgcattaatttgttgtcgaatttgaaagttaat |
228 |
Q |
| |
|
||||||| ||||| ||| |||||| ||||||||||||| ||||||||| || ||| |||| ||| | | ||||||||||||||||||| |||||||| |
|
|
| T |
1922530 |
aataacaatgttttacataattagtgcaaccaatatagtattcctttcatc---ccacaatagtagtcacgttaatttgttgtcgaatttaaaagttaac |
1922434 |
T |
 |
| Q |
229 |
tgatgatttggctataacttgattaggttccttaaa |
264 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
1922433 |
cgatgatttggctataactcgattaggttccttaaa |
1922398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University