View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_47 (Length: 265)
Name: NF1368_high_47
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 39753669 - 39753839
Alignment:
| Q |
17 |
gtattgtggcaggttcattctctcgaaccgctgttaattatgctgctggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753669 |
gtattgtggcaggttcattctctcgaaccgctgttaattatgctgctggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatc |
39753768 |
T |
 |
| Q |
117 |
actgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753769 |
actgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctc |
39753839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University