View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_53 (Length: 261)
Name: NF1368_high_53
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_53 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 152 - 261
Target Start/End: Original strand, 32195811 - 32195912
Alignment:
| Q |
152 |
gatcaattcgattgaattcaaatgaataatgaactacacttaaaaagcaaatggttaagagtttgaaaaaccttttacaaaagagtttactatctatttg |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32195811 |
gatcaattcgattgaactcaaatgaataatgaactaca--------gggaatggttaagagtttgaaaaaccttttacaaaagagtttactatccatttg |
32195902 |
T |
|
| Q |
252 |
ttatgtgaga |
261 |
Q |
| |
|
| |||||||| |
|
|
| T |
32195903 |
tcatgtgaga |
32195912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University