View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_high_58 (Length: 251)
Name: NF1368_high_58
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 57 - 235
Target Start/End: Original strand, 32196137 - 32196315
Alignment:
| Q |
57 |
taattcgtaaatttaagatacaaaatgtttgccaaaataacagtaaaactcaatgtgtgacactaatacaattatcgtgtatgtagcgagtaaacacctt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32196137 |
taattcgtaaatttaagatacaaaatgtttgccaaaataacagtaaaactcaatgtgtgacactgatacaattatcgtgtatgtagcgagtaaacacctt |
32196236 |
T |
 |
| Q |
157 |
gtcttatgtatctccatgtgtgttacactaagcacttgcgtcatttctccgcatatgtcccctataaggtttctaaaga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32196237 |
gtcttatgtatctccatgtgtgttacactaggcacttgcgtcatttctccgcatatgtcccctataaggtttctaaaga |
32196315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University