View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_30 (Length: 345)
Name: NF1368_low_30
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 32 - 335
Target Start/End: Original strand, 7438074 - 7438377
Alignment:
| Q |
32 |
gaaagggattggtatggaaggagggaaacaaggaagtttactgtgtgtgacgcatacagcacaaatcaaatgcagctatcattttcacaatatcattatc |
131 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7438074 |
gaaagggattggtgtggaaggagggaaacaaggaagtttactgtgtgtgacgcagacaacacaaataaaatgcagctatcattttcacaatatcattatc |
7438173 |
T |
 |
| Q |
132 |
catgcaattgtaatccatggaaaggccaacgcatccatgtgttgggctaataatattgaggcttttatatataaatagagtatatgcattaattatttac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438174 |
catgcaattgtaatccatggaaaggccaacgcatccatgtgttgggctaataatattgaggcttttatatataaatagagtatatgcattaattatttac |
7438273 |
T |
 |
| Q |
232 |
gagcaagtaatttagtgtttgaatgatagaaccagttctgaggttgggaggcctattatagttgttcttttgattttaggtcgacattctttataagatc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438274 |
gagcaagtaatttagtgtttgaatgatagaaccagttctggggttgggaggcctattatagttgttcttttgattttaggtcgacattctttataagatc |
7438373 |
T |
 |
| Q |
332 |
tgtg |
335 |
Q |
| |
|
|||| |
|
|
| T |
7438374 |
tgtg |
7438377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 7451452 - 7451488
Alignment:
| Q |
32 |
gaaagggattggtatggaaggagggaaacaaggaagt |
68 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7451452 |
gaaagggattagtatggaaggagggaaacatggaagt |
7451488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University