View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_33 (Length: 342)
Name: NF1368_low_33
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 32 - 342
Target Start/End: Original strand, 32643248 - 32643555
Alignment:
| Q |
32 |
tactttatatcatacggtagttttatattattgtggttcatgtatacctcccaagcataaatacattgcatcagagagcgttgcatatataaatatggta |
131 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32643248 |
tactttatatcatatggtagttttatata---gtggttcatgtatacctcccaagcataaatacattgcatcagagagcgttgtatatataaatatggta |
32643344 |
T |
|
| Q |
132 |
ttttactaatataaaaccacaactcgccacatctcactttcttctaacgtccctttaacctgtcatcatcatggataggtctttgttcgtcacacagact |
231 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
32643345 |
ttttactaatataaaaccataactcgccacatctcactttcttctaacgtccctttaacctgtcatcatcatggataagcctttgtttgtcacacagact |
32643444 |
T |
|
| Q |
232 |
cctatcaccactgatgagcttaacattttttaccaaattgatcgtgagctattttgttttttgatcttcaaacttcaccacgaggtgactcaatctcttc |
331 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643445 |
cctatcaccactgatgagcttaaccttttttaccaaattgatcgtgagctattttgttttttgatcttcaaacttcaccacgaggtgactcaatctcttc |
32643544 |
T |
|
| Q |
332 |
tagtcatggct |
342 |
Q |
| |
|
||||||||||| |
|
|
| T |
32643545 |
tagtcatggct |
32643555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University