View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_37 (Length: 320)
Name: NF1368_low_37
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 47 - 286
Target Start/End: Original strand, 37926539 - 37926790
Alignment:
| Q |
47 |
tataaaaatatgtgcattttagatgtgcttatcaagcagtcatgtgcagtctgaaaaggagcacacacaattgcctgcataaatagttagcatagagaga |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926539 |
tataaaaatatgtgcattttagatgtgcttatcaagcagtcatgtgcagtctgaaaaggagcacacacaattgcctgcataaatagttagcatagagaga |
37926638 |
T |
|
| Q |
147 |
gaacatgatttatatttggtctaaattattaggccactgccaggaatattgtcaatatg------------aaataaactatttaaaacagttctatttt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37926639 |
gaacatgatttatatttggtctaaattattaggccactgccaggaatattgtcaatatgacattgactgctaaataaactatttaaaacagttctatttt |
37926738 |
T |
|
| Q |
235 |
ttctttcaatttggatgcattgattttaagattgaattattgatttcaattg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926739 |
ttctttcaatttggatgcattgattttaagattgaattattgatttcaattg |
37926790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University