View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_38 (Length: 314)
Name: NF1368_low_38
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_38 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 204 - 314
Target Start/End: Original strand, 4238357 - 4238467
Alignment:
| Q |
204 |
gtatgaacctctcactgtgaaattcccacatgagaaaatccaaatccaccgtcttatatttaagatcagtaagtaacaccagaagatatatccaccagaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4238357 |
gtatgaacctctcactgtgaaattcccacatgagaaaatccaaatccaccgtcttatatttaagatcagtaagtaacaccagaagatatatccaccagaa |
4238456 |
T |
 |
| Q |
304 |
gtcgtgccgcc |
314 |
Q |
| |
|
||||||||||| |
|
|
| T |
4238457 |
gtcgtgccgcc |
4238467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 4238185 - 4238284
Alignment:
| Q |
28 |
caaaacttttctttaattcaccatagtaaatgcaggagtaatgcaacacaaaccttattttggttgtgctgcatgtaaatctgcttgatttcacaactaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
4238185 |
caaaacttttctttaattcaccatagtaaatgcaggtgtaatgcaaaacaaaccttattttggttgtgctgtatttaaatctgcttgatttcacaactaa |
4238284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University