View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_42 (Length: 306)
Name: NF1368_low_42
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 53 - 296
Target Start/End: Original strand, 4928810 - 4929055
Alignment:
| Q |
53 |
actaaatgtgttccaatattttcattctccggcacaaattatggaagtnnnnnnnnnn--ctttaagaactaaaatggtatatgcaattttatgtcgtga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4928810 |
actaaatgtgttccaatattttcattctccggcacaaattatggaagtaaaaaaaaaaaactttaagaactaaaatggtatatgcaattttatgtcgtga |
4928909 |
T |
 |
| Q |
151 |
actaattttggtcttttcgcatatttaatgcagataattttagaagttagactaaatgcttttgctgacaggtacatatggtttcatcgcaccagagtat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4928910 |
actaattttggtcttttcgcatatttaatgcagataattttagaagttagactaaatgcttttgctgacaggtccatatggtttctgtgcaccagagtat |
4929009 |
T |
 |
| Q |
251 |
ctgcaaaccggaatttacacagataaatgtgacgtttactcctttg |
296 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4929010 |
ctgcaaaccagaacttacacagataaatgtgacgtttactcctttg |
4929055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University