View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_43 (Length: 304)
Name: NF1368_low_43
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 39753669 - 39753947
Alignment:
| Q |
17 |
gtattgtggcaggttcattctctcgaaccgctgttaattatgctgctggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753669 |
gtattgtggcaggttcattctctcgaaccgctgttaattatgctgctggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatc |
39753768 |
T |
|
| Q |
117 |
actgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctctacctggactcatagacataaatgaagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753769 |
actgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctctacctggactcatagacataaatgaagct |
39753868 |
T |
|
| Q |
217 |
tacaaaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttggtgtactctttgcttctgtgg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753869 |
tacaaaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttggtgtactctttgcttctgtgg |
39753947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 39745350 - 39745404
Alignment:
| Q |
221 |
aaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttgg |
275 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||||||||| || |||||||| |
|
|
| T |
39745350 |
aaatttggaaggttgataaaattgattttcttgcttgtgctggagccttctttgg |
39745404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University