View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_46 (Length: 293)
Name: NF1368_low_46
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 112 - 268
Target Start/End: Original strand, 32358987 - 32359137
Alignment:
| Q |
112 |
tgtgcaattgtaacaagctgctgcaaatttcattaaccctatacagctgaatataagcaagctttcatctttttattcaagttgtataactagaagctta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358987 |
tgtgcaattgtaacaagctgctgcaaatttcattaaccctattcagctgaatat----aagctttcatctttttattcaagttgtataactagaagctta |
32359082 |
T |
|
| Q |
212 |
atgctctgattgtatgataaactagtcatttgttggattttcaattattgctctctg |
268 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32359083 |
atg--ctgattgtatgataaactagtcatttgttgaattttcaattactgctctctg |
32359137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 32372465 - 32372509
Alignment:
| Q |
72 |
gaaagattgcacagatgtatgaaggttgtcaattcatttatgtgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32372465 |
gaaagattgcacagatgtatgaaggttgtcaactcatttttgtgc |
32372509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University