View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_47 (Length: 291)
Name: NF1368_low_47
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 48 - 239
Target Start/End: Original strand, 44446117 - 44446308
Alignment:
| Q |
48 |
tgagatgaactacaaatttaactattaaagattacactttcacgtgtgtatgaaactcaaaccaacattttcatcttttcatgaaaaatgttggtacaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44446117 |
tgagatgaactacaaatttaactattaaagattacactttcacgtgtgtatgaaactcaaaccaacattttcatcttttcatgacaaatgttggtacaat |
44446216 |
T |
 |
| Q |
148 |
taacatttcttttaggagaagggatcaaacactcgccctccttatcacttcacttcttaactgcttcgccccaaccaccaaaccaacttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44446217 |
taacatttcttttaggagaagggatcaaacactcgccctccttatcacttcacttcataactgcttcgccccaaccaccaaaccaacttcat |
44446308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University