View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_48 (Length: 291)
Name: NF1368_low_48
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_48 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 60 - 291
Target Start/End: Original strand, 50750589 - 50750819
Alignment:
| Q |
60 |
gagttggcatttcaaatatggtgcacaagattgccaatcatgagtatatgggatttgagaatatctgcaagtacggatcatagcacatttactttctggt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50750589 |
gagttggcatttcaaatatggtgcacaagattgccaatcatgagtatatgggatttgagaatatctgcaagtacggatcatagcacatttactttctagt |
50750688 |
T |
|
| Q |
160 |
gttttacactattattcagaaattgcgtaccaaggccaagagctaaggtggccatgatagattatttcttatcctgttagaaggtgtcattttttattat |
259 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50750689 |
gttt-acactattattcaaaaattgcgtaccaaggccaagagctaaggtggccatgatagattatttcttatcctgttagaaggtgtcattttttattat |
50750787 |
T |
|
| Q |
260 |
tgccaagtcatggagtgattccgtaggaaact |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50750788 |
tgccaagtcatggagtgattccgtaggaaact |
50750819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University