View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_54 (Length: 265)
Name: NF1368_low_54
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_54 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 52 - 265
Target Start/End: Complemental strand, 31264890 - 31264677
Alignment:
| Q |
52 |
catggtatcacattcaccaaatattggtgctgaagtatatcacggttttagttagttttgctaacttaggtatagaatgttagactagactacacatctt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31264890 |
catggtatcacattcaccaaatattggtgctgaagtatatcacggttttagttagttttgctaacttaggtatagaatgttagactagactacacatctt |
31264791 |
T |
|
| Q |
152 |
gacattgatcatgtgatcatgattccctagattgcctcaaatgtggggactgcacaaaaatcatgtgtagaaatagtgagaacgaaactaacttgaatga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31264790 |
gacattgatcatgtgatcatgattccctagattgcctcaaatgtggggactgcacaaaaatcatgtgtagaaatagtgagaacgaaactaacttgaatga |
31264691 |
T |
|
| Q |
252 |
agaagcttgtcaaa |
265 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31264690 |
agaagcttgtcaaa |
31264677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University