View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1368_low_61 (Length: 261)

Name: NF1368_low_61
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1368_low_61
NF1368_low_61
[»] chr1 (1 HSPs)
chr1 (152-261)||(32195811-32195912)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 152 - 261
Target Start/End: Original strand, 32195811 - 32195912
Alignment:
152 gatcaattcgattgaattcaaatgaataatgaactacacttaaaaagcaaatggttaagagtttgaaaaaccttttacaaaagagtttactatctatttg 251  Q
    |||||||||||||||| |||||||||||||||||||||        |  ||||||||||||||||||||||||||||||||||||||||||||| |||||    
32195811 gatcaattcgattgaactcaaatgaataatgaactaca--------gggaatggttaagagtttgaaaaaccttttacaaaagagtttactatccatttg 32195902  T
252 ttatgtgaga 261  Q
    | ||||||||    
32195903 tcatgtgaga 32195912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University