View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_73 (Length: 221)
Name: NF1368_low_73
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_73 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 17443555 - 17443765
Alignment:
| Q |
12 |
tgtgtagttcataatttattcatgatgttgggtgagagtagctctccatgtttggccttatttcttt-ctagtttcacgacatttttgtt-attatccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
17443555 |
tgtgtagttcataatttattcatgttgttgggtgagagtagctctccatgtttggcct-atttcttttctagtttcacgacatttttttttattatccaa |
17443653 |
T |
 |
| Q |
110 |
atgtacttattttgttcacaacatgcctttgtaaaacagttcagattaataaacgctataaacatgaaacacaagtaaaccatcatattgtcaagttcca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17443654 |
atgtacttattttgttcacaacatgcctttgtaaaatagttcagattaataaacgctataaacatgaaacacaagtaaaccatcatattgtcaagttcca |
17443753 |
T |
 |
| Q |
210 |
tcgacatgtatt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17443754 |
tcgacatgtatt |
17443765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University