View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_75 (Length: 213)
Name: NF1368_low_75
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 30666825 - 30666642
Alignment:
| Q |
1 |
tgattttattactatggtttgtaaatgaagtttcttttgatctaacttgtgatgatggtgttttaggtacaactttgacaacactatggatggattttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30666825 |
tgattttattactatggtttgtaaatgaagtttcttttgatctaacctgtgatgatggtgttttaggtacaactttgacaacactatggatggattttac |
30666726 |
T |
|
| Q |
101 |
attgctcctgcttttatggacaagcttgttgttcacatcaccaagaatttcttgaccctaccaaacatcaaggtatgtaaattt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30666725 |
attgctcctgcttttatggacaagcttgttgttcacatcaccaagaatttcttgaccctaccaaacatcaaggtatgtaaattt |
30666642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 52 - 180
Target Start/End: Complemental strand, 34436585 - 34436457
Alignment:
| Q |
52 |
atgatggtgttttaggtacaactttgacaacactatggatggattttacattgctcctgcttttatggacaagcttgttgttcacatcaccaagaatttc |
151 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||||| ||| |
|
|
| T |
34436585 |
atgatggtatttcaggtacaaccttgacaacaccatggatggtttttacattgcacctgcttttatggacaagcttgttgtacacatcactaagaacttc |
34436486 |
T |
|
| Q |
152 |
ttgaccctaccaaacatcaaggtatgtaa |
180 |
Q |
| |
|
||||| || || || |||||||||||||| |
|
|
| T |
34436485 |
ttgactctgcctaatatcaaggtatgtaa |
34436457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 101 - 147
Target Start/End: Complemental strand, 6854189 - 6854143
Alignment:
| Q |
101 |
attgctcctgcttttatggacaagcttgttgttcacatcaccaagaa |
147 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6854189 |
attgcacctgcatttatggacaagcttgttgttcacatcactaagaa |
6854143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University