View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1368_low_76 (Length: 211)
Name: NF1368_low_76
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1368_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 25379186 - 25379365
Alignment:
| Q |
1 |
agtcttgaagaatagaagattgtggtttaccatcagtggtttgaggccttttgttctttctccttgaattttgtctcctttttgttgcattccaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379186 |
agtcttgaagaatagaagattgtggtttaccatcagtggtttgaggccttttgttctttctccttgaattttgtctcctttttgttgcattccaatgatt |
25379285 |
T |
 |
| Q |
101 |
ctttattgcattctcagttcttccaggaattctctttgctatctccgcccaacgatttccaatcatgccatgagtttcaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25379286 |
ctttattgcattctcagttcttccaggaattctctttgctatctctgcccaacgatttccaatcatgccatgagtttcaa |
25379365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 51 - 163
Target Start/End: Original strand, 29671189 - 29671301
Alignment:
| Q |
51 |
ttgttctttctccttgaattttgtctcctttttgttgcattccaatgattctttattgcattctcagttcttccaggaattctctttgctatctccgccc |
150 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
29671189 |
ttgttctttcttcttgaattttgtcttctttttgtggcattccaatgattttttatggcattttcagttcttcctggaatcttctttgctatctcagccc |
29671288 |
T |
 |
| Q |
151 |
aacgatttccaat |
163 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
29671289 |
aacggtttccaat |
29671301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 81 - 151
Target Start/End: Complemental strand, 43866564 - 43866494
Alignment:
| Q |
81 |
tttgttgcattccaatgattctttattgcattctcagttcttccaggaattctctttgctatctccgccca |
151 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||| || | ||| || || ||||||||||| |
|
|
| T |
43866564 |
tttgttgcattccaatggttttttattgcattctcagttcttcctggcaatcttttcgcaatctccgccca |
43866494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University