View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369-INSERTION-4 (Length: 261)
Name: NF1369-INSERTION-4
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369-INSERTION-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 5661258 - 5661512
Alignment:
| Q |
7 |
acctttattgctaagagatctcacttttgtgtttcttagaaccttttgcgattgctttaatcttttataatttaaaaaacagttgttgccttgtgttaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5661258 |
acctttattgctaagagatctcacttttgtgtttcctagaacctattgcgattgctttaatcttttataatttaaaaaacagttgttgccttgtgttaac |
5661357 |
T |
|
| Q |
107 |
aagtaatttatcatgtaaccnnnnnnnnncaagtaactcctctgggttacaaaatgccatcaatttttagtacaacaaacaatcata-nnnnnnnnngtt |
205 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||| |
|
|
| T |
5661358 |
aagtaattcatcatgtaacc-aaaaaaaacaagtaactcctctgggttacaaaatgccatcaatttttagcagaacaaacaatcatattttttttgtgtt |
5661456 |
T |
|
| Q |
206 |
aaccctcctgatttagggagagatgtcccgataatttagaattggtatgtgagata |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5661457 |
aaccctcctgatttagggaaagatgtcccgataatttagaattggtatgtgagata |
5661512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University