View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1369-INSERTION-8 (Length: 84)
Name: NF1369-INSERTION-8
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1369-INSERTION-8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 5e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 12 - 84
Target Start/End: Original strand, 8096197 - 8096269
Alignment:
| Q |
12 |
tttcatccagagtaagtcaatttaaacaacattttgtgtttttcttcctttttcttccttcatattgatgttt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8096197 |
tttcatccagagtaagtcaatttaaacaacattttgtgtttttcttcctttttcttccttcatattgatgttt |
8096269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University