View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13691_high_8 (Length: 244)
Name: NF13691_high_8
Description: NF13691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13691_high_8 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 23817455 - 23817232
Alignment:
| Q |
21 |
cccaggctcccccagtgacccaacagtaaagacatatgggaaaggtgaatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23817455 |
cccaggctcccccagtgacccaacagtaaagacatatgggaaaggtgaatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcac |
23817356 |
T |
 |
| Q |
121 |
attcatttatgacttgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23817355 |
attcatttatgacttgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagct |
23817256 |
T |
 |
| Q |
221 |
gcaaagtggaatggaaaccccttt |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23817255 |
gcaaagtggaatggaaaccccttt |
23817232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 23826812 - 23826752
Alignment:
| Q |
135 |
tgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaa |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
23826812 |
tgttatgggaacagaagcatggtgtaactgtaagggacccc--tttttttgttttgtttggaa |
23826752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 23830966 - 23830928
Alignment:
| Q |
60 |
gaaaggtgaatgggacgaaggaaggtgagtatggtgatt |
98 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
23830966 |
gaaaggtaaaggggacgaaggaaggtgagtatggtgatt |
23830928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University