View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13692_high_12 (Length: 331)
Name: NF13692_high_12
Description: NF13692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13692_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 33 - 312
Target Start/End: Complemental strand, 49812664 - 49812385
Alignment:
| Q |
33 |
agccattgaaatataaaagcatatccaattcaattcttcattgatcatacatattctttgttttggaggttgtttgtttgtgtttatcaccggcatgggt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812664 |
agccattgaaatataaaagcatatccaattcaattcttcattgatcatacatattctttgttttggaggttgtttgtttgtgtttatcaccggcatgggt |
49812565 |
T |
 |
| Q |
133 |
aagggtgacattgaggctgggttttcccacgcacatggcgacagcctgtatccgtcgatgatagagtcacctgagctccgatggggtttcatccgtaaag |
232 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812564 |
aagggtgacattgaggctggattttcccacgcacatggcgacaacctgtatccgtcgatgatagagtcacctgagctccgatggggtttcatccgtaaag |
49812465 |
T |
 |
| Q |
233 |
tttacatcattgtttccattcagcttctgctcacagctggtgttgcatgctttttcatgttttttccaccagcaagggat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812464 |
tttacatcattgtttccattcagcttctgctcacagctggtgttgcatgctttttcatgttttttccaccagcaagggat |
49812385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University