View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13692_high_16 (Length: 280)
Name: NF13692_high_16
Description: NF13692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13692_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 180 - 276
Target Start/End: Original strand, 1132351 - 1132447
Alignment:
| Q |
180 |
acatagagtattaccggtggcagaaatggatgattgagactcaatagttgcagtgatggtggagttcttgggagtgaggttttgggagcaaacaaga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1132351 |
acatagagtattaccggtggcagaaatggatgattgagactcaatagttgcagtgatggtggagttcttgggagtgaggttttgggagcaaacaaga |
1132447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 1132188 - 1132268
Alignment:
| Q |
16 |
cagaaacatatttctttgtgttggtttttagtacttattgtcgttttgtctatctactcaagagaagaaccatatctcttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1132188 |
cagaaacatatttctttgtgttggtttccagtacttattgtcgtttcgtctatctactcaagagaagaaccatatctcttg |
1132268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 1132288 - 1132320
Alignment:
| Q |
117 |
gttcattcaatttttgctagcataatttatact |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1132288 |
gttcattcaatttttgctagcataatttatact |
1132320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University